Skip to main content

Table 1 Primer sequence of virulence genes detection by PCR

From: Occurrence of ingression of Salmonella spp. in Betel leaf (Piper betle L.)

Gene Virulence factor Primer sequence (5’–3’) Base pair (bp)
sefA Fimbria GATACTGCTGAACGTAGAAGG 488
GCGTAAATCAGCATCTGCAGTAGC
invA Invasion GTGAAATTATCGCCACGTTCGGGCAA 284
TCATCGCACCGTCAAAGGAACC
hilA Invasion CTGCCGCAGTGTTAAGGATA 497
CTGTCGCCTTAATCGCATGT
avrA Effector protein of TTSS GTTATGGACGGAACGACATCGG 385
ATTCTGCTTCCCGCCGCC
sopE Effector protein of TTSS ACACACTTTCACCGAGGAAGCG 398
GGATGCCTTCTGATGTTGACTGG
spvC Plasmid - virulence CGGAAATACCATCTACAAATA 669
CCCAAACCCATACTTACTCTG